Short segments of newly synthesized DNA are joined into a continuous strand by
ligase

Question

09-12-2022
Biology

Answered

Short segments of newly synthesized DNA are joined into a continuous strand by
ligase

Answer :

Other Questions

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following require physical contact between two bacterial cells for dna transfer?

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

contexto1026 contexto1026 · Answer 1 · 2022-12-15T14:58:43-05:00

Short segments which is newly synthesized DNA and have joined a continuous strand by using ligase.

The DNA ligase enzyme joins these tiny fragments of newly manufactured DNA, which are known as Okazaki fragments after their discoverer. This results in the formation of a complete new DNA strand. Okazaki fragments are the brief pieces of freshly synthesized DNA that serve as the foundation for the lagging strand.

The DNA helicase separates the strands while the primase and polymerase must continuously stop and start since they travel in the opposite direction of the fork. Once the pieces have been created, DNA ligase joins them together to form a single, continuous strand. Okazaki fragments are brief pieces of DNA that have undergone replication. The lagging strand, which is made of Okazaki fragments, is a kind of DNA. The DNA ligase enzyme joins these pieces together.

To learn more about DNA visit : brainly.com/question/2131506

#SPJ4

Correct Question:

Short segments of newly synthesized DNA are joined into a continuous strand by _____.

Short segments of newly synthesized DNA are joined into a continuous strand by ligase

Answer :

Other Questions

Short segments of newly synthesized DNA are joined into a continuous strand by
ligase