elliep1125 elliep1125

23-12-2022
Biology

Answered

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs with __ and c always pairs with _

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

This data table shows how quickly rope will rot away in freshwater and saltwater. what can you conclude about the rates of the rotting reaction? A. The reaction

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

A somatic mutation is: a. heritable b. always harmful c. always caused by a mutagen d. none of the options listed here

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

which of the following require physical contact between two bacterial cells for dna transfer?

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll