dylantyler5897 dylantyler5897

23-12-2022
Biology

Answered

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing damaged dna

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

which of the following require physical contact between two bacterial cells for dna transfer?

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

Under optimal conditions the number of DNA molecules amplified from a single molecule in a PCR after 30 amplification cycles will be A) 30 B) 30 x 2 C) 30^2 D)

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi