Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA: CUAACCGUAUUGCUAUUAGCUAGCCAUG
In a frameshift mutation, one or more nucleotide bases of the DNA is accidentally lost or added. If a frameshift mutation occurred that caused the second T in the top DNA strand above (question 3) to be lost (deleted) as well as its corresponding base pair below), what would the new coding DNA strand and the new mRNA codons be? Write then in from the beginning in threes. DNA: RNA: