Liantic2717 Liantic2717

23-12-2022
Biology

Answered

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that would be transcribed from the bottom strand of the DNA: CUAACCGUAUUGCUAUUAGCUAGCCAUG
In a frameshift mutation, one or more nucleotide bases of the DNA is accidentally lost or added. If a frameshift mutation occurred that caused the second T in the top DNA strand above (question 3) to be lost (deleted) as well as its corresponding base pair below), what would the new coding DNA strand and the new mRNA codons be? Write then in from the beginning in threes. DNA: RNA:

Answer :

Other Questions

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

29. In a genetic engineering experiment a piece of double-stranded DNA containing 18000 nucleotides coding for a specific polypeptide is transcribed and transl

which of the following require physical contact between two bacterial cells for dna transfer?

Under optimal conditions the number of DNA molecules amplified from a single molecule in a PCR after 30 amplification cycles will be A) 30 B) 30 x 2 C) 30^2 D)

A somatic mutation is: a. heritable b. always harmful c. always caused by a mutagen d. none of the options listed here

blood cells could be modified to better carry oxygen, which would help the athlete's muscles to not get sore as fast. lactic acid wouldn't build up as fast eith