jennyrr7561 jennyrr7561

23-12-2022
Biology

Answered

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes covalently connects segments of dna?

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

which of the following require physical contact between two bacterial cells for dna transfer?

Under optimal conditions the number of DNA molecules amplified from a single molecule in a PCR after 30 amplification cycles will be A) 30 B) 30 x 2 C) 30^2 D)

Refer to the equation below to answer this question. What are the REACTANTS of this chemical reaction??

Refer to the equation below to answer this question. What are the REACTANTS of this chemical reaction??

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

The graph below shows what happens during both chemical reactions A and B. Which of the following BEST describes this graph

29. In a genetic engineering experiment a piece of double-stranded DNA containing 18000 nucleotides coding for a specific polypeptide is transcribed and transl