Bananaman88751 Bananaman88751

23-12-2022
Biology

Answered

which of the following require physical contact between two bacterial cells for dna transfer?

Answer :

Other Questions

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

The development of virulent, toxin-producing bacterial strains due to the presence of a temperate phage can occur in OA. Bacterial conjugation B. Transformation

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of a growing protein chain when a. the ribosomal RNA anticodo

Sort the following list so that the stages of meiosis 1 appear in order. Remember You start with 1 cell and end with 2 cells

-------- alveolar cells provide the primary diffusional area for gas exchange with the blood in the lung

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil