sweetycakes1516 sweetycakes1516

23-12-2022
Biology

Answered

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

Answer :

Other Questions

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following require physical contact between two bacterial cells for dna transfer?

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

variegated limpets are a different species from olive limpets. they live on the same rocky benches along the same sea shore, and eat the same kinds of foods. th

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

Under optimal conditions the number of DNA molecules amplified from a single molecule in a PCR after 30 amplification cycles will be A) 30 B) 30 x 2 C) 30^2 D)