sharonbland2972 sharonbland2972

23-12-2022
Biology

Answered

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of which cycle?

Answer :

Other Questions

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co