Angeliquegrace4395 Angeliquegrace4395

23-12-2022
Biology

Answered

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c a a t 3' 5' c t a g t t g t g c a a t 3' 5' c t a g t t g c a a t 3'

Answer :

Other Questions

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

which of the following require physical contact between two bacterial cells for dna transfer?

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

g ou have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove their

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit