unzips the dna double helix test your knowledge of how dna replication works by matching the enzyme to its function. t/f

Question

05-12-2022
Biology

Answered

unzips the dna double helix test your knowledge of how dna replication works by matching the enzyme to its function. t/f

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

explain the following terms: dna,chromosomes,sister chromosomes homologous chromosomes and replication chromosomes

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

which of the following require physical contact between two bacterial cells for dna transfer?

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi

which of the following is thought to have been the first step in the origin of life? group of answer choices replication of primitive genes formation of polypep

jaiswalsaurabh45609 jaiswalsaurabh45609 · Answer 1 · 2022-12-07T23:40:42-05:00

Helicase unzips the DNA double helix.

A group of enzymes known as helicases is regarded to be essential for all living things. Their major job is to unravel the genetic code of a creature. Helicases are motor proteins that use the energy from ATP hydrolysis to move in one direction along a nucleic acid phosphodiester backbone and separate two hybridized nucleic acid strands.

Helicases are quite important as without them the DNA replication process cannot proceed. Thus, play important role in replication.

To know more about helicase, click here,

brainly.com/question/9787806

#SPJ4