Explain what 5' and 3' ends mean in regards to DNA structure?

Question

15-12-2022
Biology

Answered

Explain what 5' and 3' ends mean in regards to DNA structure?

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

explain the following terms: dna,chromosomes,sister chromosomes homologous chromosomes and replication chromosomes

which of the following require physical contact between two bacterial cells for dna transfer?

(b) based on the diagram, describe how the structure of these organelles controls movement across the membranes.

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

kumarravichandra kumarravichandra · Answer 1 · 2022-12-25T00:51:00-05:00

The DNA molecule has a number on each end. The length is denoted by the numbers 5' (five prime) on one end and 3' on the other (three prime). The numbers 5' and 3' indicate how many carbon atoms in a deoxyribose sugar molecule a phosphate group is bound to.

DNA nucleotides link up to form units referred to as base pairs, A with T and C with G. A sugar and phosphate molecule are also joined to each base. A nucleotide is made up of a base, a sugar, and a phosphate. The double helix is a spiral formed by two long strands of nucleotides.What are the structure and purposes of DNA?

All of an organism's future protein synthesis will be governed by the genetic information encoded in its DNA. DNA is located in the cell nucleus of eucaryotes. Two Complementary Chains of Nucleotides Make Up a DNA Molecule. A Heredity Mechanism is Provided by the DNA Structure.

Learn more about DNA here:

https://brainly.com/question/264225

#SPJ4