Transgenic organisms receive ________ DNA, which is genetic material that has been spliced together from other organisms.

Question

06-12-2022
Biology

Answered

Transgenic organisms receive ________ DNA, which is genetic material that has been spliced together from other organisms.

Answer :

Other Questions

when a stem cell differentiates and changes in size and shape, specific genes are being(1 point) responses spliced. spliced. copied. copied. transcribed. transc

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

Transcription of a part of a DNA molecule with a nucleotide sequence of A-A-A-C-A-A-C-T-T results in a mRNA molecule with the complementary sequence of:

You are a researcher on a behavior genetics study studying identical and fraternal twins; based on what has been discussed in lectures, you would propose that t

RupaBera RupaBera · Answer 1 · 2022-12-10T12:41:37-05:00

Foreign DNA has been inserted via biotechnology into transgenic organisms. Here, "foreign DNA" (the transgene) is defined as DNA from a different species or, alternatively, as recombinant DNA from the same species that has undergone laboratory manipulation and subsequently been reintroduced.

What term describes DNA from several organisms that has been spliced together?

Recombinant DNA molecules, which are created by joining two or more DNA pieces, have allowed for a wide variety of new cell-biological research methods.

Which DNA combinations may transgenic organisms contain?

An creature that has undergone recombinant DNA technology—which either entails fusing DNA from various genomes or inserting foreign DNA into a genome—is referred to as transgenic or genetically engineered.

To know more about Transgenic organisms visit :-

https://brainly.com/question/4372248

#SPJ4