charlzperru5780 charlzperru5780

23-12-2022
Biology

Answered

when a stem cell differentiates and changes in size and shape, specific genes are being(1 point) responses spliced. spliced. copied. copied. transcribed. transcribed. expressed.

Answer :

Other Questions

29. In a genetic engineering experiment a piece of double-stranded DNA containing 18000 nucleotides coding for a specific polypeptide is transcribed and transl

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

these images illustrate a(n) a. monohybrid cross. b. complete dominance of body size alleles. c. incomplete dominance of body size alleles. d. dihybrid cross.

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

When phage nucleic acid is incorporated into the nucleic acid of its host cell and is replicated when the host DNA is replicated, this is considered part of whi