to understand the structure of eukaryotic dna, rank the following from least to most condensed.

Question

05-12-2022
Biology

Answered

to understand the structure of eukaryotic dna, rank the following from least to most condensed.

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

which of the following require physical contact between two bacterial cells for dna transfer?

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

(b) based on the diagram, describe how the structure of these organelles controls movement across the membranes.

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

kumarravichandra kumarravichandra · Answer 1 · 2022-12-12T01:32:53-05:00

From the least to the most compact, eukaryotes' levels of chromatin compaction. (least dense) DNA leads to a nucleosome, a solenoid, loop domains, a chromatid, and a chromosome in metaphase (most compact)

With the use of condensing or compaction chemicals, elongated, negatively charged double-helical random coils of DNA are transformed into smaller, charge-neutralized micro- or nano-sized compact structures.

The chromatin, a combination of DNA and proteins found in the nucleus, condenses during prophase. The development of discernible chromosomes is caused by the coiling and tightening of the chromatin. One well organized piece of DNA makes up each chromosome.

The nucleosome is thought to be the simplest form of chromatin organization. It is primarily made up of DNA fragments that histones wrap around. Lysine and arginine make up the amino acid histone.

To know more about DNA click here

brainly.com/question/21992450

#SPJ4