all of the following are reasons it might be beneficial for bacteria to take up foreign dna except that

Question

05-12-2022
Biology

Answered

all of the following are reasons it might be beneficial for bacteria to take up foreign dna except that

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following require physical contact between two bacterial cells for dna transfer?

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

rathipushpendra345 rathipushpendra345 · Answer 1 · 2022-12-08T05:50:09-05:00

With the exception of eating foreign DNA, all of the following justifications for bacterial uptake of foreign DNA are advantageous.

The transformation of exogenous, DNase-sensitive DNA into a DNase-protected state inside a bacterium is known as DNA absorption. This DNA uptake in gram-negative bacteria can be accomplished by breaking through the outer membrane. In contrast, DNA uptake in gram-positive bacteria occurs with passage over the cytoplasmic membrane and is comparable to that of gram-negative bacteria.

Bacterial DNA absorption is advantageous since it aids in the creation of recombinants that may be applied to a variety of situations. Patients with hereditary diseases can employ DNA uptake to repair broken chromosomes and DNA.

In organisms like bacteria, new genes can be introduced for various purposes.

Option A is the right response, so that is what it is.

The complete question is:-

All of the following are reasons it might be beneficial for bacteria to take up foreign DNA EXCEPT that Question 77 options: a) DNA could be used for food by bacteria. b) the uptake of foreign DNA would result in potentially beneficial recombinants. c) the uptake of foreign DNA might allow a cell to repair damaged chromosomes. d) the uptake of foreign DNA could allow completely new genes with new functions to enter the recipient cell. e) the uptake of foreign DNA could result in the breakage of the plasma membrane of the recipient cell.

To learn more about DNA, refer:-

https://brainly.com/question/11698931

#SPJ4