jossy5988 jossy5988

23-12-2022
Biology

Answered

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of coli in this experiment?

Answer :

Other Questions

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

Neural mechanisms that may help explain some of the strength gains from resistance training include all except A. increased synchronization of motor unit activa

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

the ultimate goal of cellular respiration is to produce atp. cells use two different mechanisms to do this: substrate level phosphorylation and oxidative phosph

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

29. In a genetic engineering experiment a piece of double-stranded DNA containing 18000 nucleotides coding for a specific polypeptide is transcribed and transl

a botanist studied a population of grasses in an area of erratic rainfall. she found that plants with curled leaves reproduced better in dry years, and those wi

in only one parent is required to produce offspring. 2. is a method of reproduction for some types of bacteria. 4. some simple organisms, such as hydras and spo

gray seed color in peas is dominant to white. assume that mendel conducted a series of experiments where plants with gray seeds were crossed among themselves, a