Match each enzyme name in the left column with the correct descriptive phrase in the right column. Drag the appropriate labels to their respective targets.
Acts through an adenylylated DNA intermediate
Catalyzes mitochondrial DNA replication
Catalyzes most nucleotide incorporations in bacterial DNA replication
Catalyzes formation of a double-strand DNA break
Cleaves RNA in a DNA - RNA hybrid
molecule
Uses a tRNA primer in synthesis of retroviral DNA
Topoisomerase II
DNA ligase
DNA polymerase y
Reverse transcriptase
DNA polymerase I
DNA polymerase III

Question

05-12-2022
Biology

Answered

Match each enzyme name in the left column with the correct descriptive phrase in the right column. Drag the appropriate labels to their respective targets.
Acts through an adenylylated DNA intermediate
Catalyzes mitochondrial DNA replication
Catalyzes most nucleotide incorporations in bacterial DNA replication
Catalyzes formation of a double-strand DNA break
Cleaves RNA in a DNA - RNA hybrid
molecule
Uses a tRNA primer in synthesis of retroviral DNA
Topoisomerase II
DNA ligase
DNA polymerase y
Reverse transcriptase
DNA polymerase I
DNA polymerase III

Answer :

Other Questions

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following require physical contact between two bacterial cells for dna transfer?

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

explain the following terms: dna,chromosomes,sister chromosomes homologous chromosomes and replication chromosomes

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

kumarravichandra kumarravichandra · Answer 1 · 2022-12-08T05:32:16-05:00

Matches for each enzyme Drag the appropriate labels to their respective targets.

A.2, B.3, C.6, D.1, E.5, F.4.

The enzyme that facilitates the creation of double-strand DNA breaks is known as topoisomerase II.

The enzyme that catalyzes through an intermediate of adenylated DNA is called DNA ligase.

An enzyme called DNA polymerase gamma works on mitochondrial DNA replication. A tRNA primer is utilized by the reverse transcriptase during the catalytic process in the creation of retroviral DNA.

In their catalytic process, DNA pol I breaks RNA in a DNA-RNA hybrid molecule. The primary enzyme responsible for the majority of nucleotide incorporations during bacterial DNA replication is DNA pol III.

Learn more about enzyme by using this link:

https://brainly.com/question/14953274

#SPJ4