which of the following statements concerning leucine zipper protein dimerization and dna binding is correct? A. Leucine zipper protein dimerization is facilitated by polar amino acids in the dimerization domains. B. Leucine zipper proteins contain many leucine amino acids in the DNA-binding region that facilitate sequence-specific DNA binding. C. Leucine zipper proteins function as a dimer with both subunits making contact with the sequence-specific DNA site. D. Leucine zipper proteins use ionic bonds to bind with the sequence-specific DNA site.

Question

05-12-2022
Biology

Answered

which of the following statements concerning leucine zipper protein dimerization and dna binding is correct? A. Leucine zipper protein dimerization is facilitated by polar amino acids in the dimerization domains. B. Leucine zipper proteins contain many leucine amino acids in the DNA-binding region that facilitate sequence-specific DNA binding. C. Leucine zipper proteins function as a dimer with both subunits making contact with the sequence-specific DNA site. D. Leucine zipper proteins use ionic bonds to bind with the sequence-specific DNA site.

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following require physical contact between two bacterial cells for dna transfer?

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

kumarkrishna kumarkrishna · Answer 1 · 2022-12-07T13:00:47-05:00

The proper statement regarding leucine zipper protein dimerization and DNA binding is that polar amino acids in the dimerization domains assist leucine zipper protein dimerization. A vital biological process called protein dimerization occurs when proteins bind to produce functional assemblies, such as homo- or heterodimers.

The leucine zipper dimerization domain consists of four to five heptads, each of which has two -helical turns or seven amino acids, designated as amino acids a, b, c, d, e, f, and g. The leucine zipper oligomerization, dimerization stability, and dimerization selectivity are controlled by amino acids in the a, d, e, and g locations. The a and d locations of amino acids are often hydrophobic because they are on the same surface of the -helix. Charged amino acids often reside in the g and e locations. The five C terminal amino acids in the g position interact with the oppositely charged amino acids in the e′ position in interhelical interactions, according to X-ray crystallography. Additionally, stability is aided by Van der Waal interactions between the underlying a and d amino acids and the g and e′ methylene groups.

Learn more about amino acids here:

https://brainly.com/question/15687833

#SPJ4