Fettysquad9212 Fettysquad9212

23-12-2022
Biology

Answered

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portions of the RNA are removed and the remaining RNA are joined together: Classify the statements regarding mRNA splicing as true or false. True statements False statements Proteins in the spliceosome recognize the 5' and 3' splice site sequences The spliceosome consists of five small RNA molecules and many associated proteins: Splicing occurs while the mRNA is attached t0 the nucleosome Splicing occurs while the mRNA is still in the nucleus_ One mRNA can sometimes code for more than one protein by splicing at alternative sites.

Answer :

Other Questions

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of a growing protein chain when a. the ribosomal RNA anticodo

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Choose statements true of transgression and regression. Sort the statements as being true of either transgression or regression.

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

alex listed the typical steps of fossil formation.1) an organism dies.2) the remains fall to the bottom of the ocean.3) the soft portions decay, and the hard po

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

which of the following statements regarding natural selection is false? natural selection depends on the local environment at the current time. natural selectio

According to Melanie Klein, which of the following statements is true about infantile paranoid-schizoid position?