You have isolated several different temperature sensitive mutant yeast strains that stop proliferating when shifted from 25c€ to 37C. You analyze these mutant strains at the two different temperatures using FACS analysis in which a machine sorts cells according to the amount 0f DNA they contain: At 25C the FACS plots for all.of the strains look like this: 2 2N 4N Amount of DNA/cell After the mutant cell cultures have been grown at 37cC you again analyze these cells using FACS The plots below represent the different plot types from muta east strains: 2 3 3 2N 4N 2N 4N 2N 4N Amount of DNA/cell Amount of DNA/cell Anount _f DNA} ~ell For each of the following temperature sensitive mutations predict which FACS plot (A,B 0 C) you would expect, and explain your answer (1 point each) A mutation in M-cyclin that prevented it from binding to M-Cdk mutation that prevented initiation of replication mutation that prevented the dephosphorylation f S-Cdk An inactivating mutation in the anaphase promoting complex (APC)

Question

05-12-2022
Biology

Answered

You have isolated several different temperature sensitive mutant yeast strains that stop proliferating when shifted from 25c€ to 37C. You analyze these mutant strains at the two different temperatures using FACS analysis in which a machine sorts cells according to the amount 0f DNA they contain: At 25C the FACS plots for all.of the strains look like this: 2 2N 4N Amount of DNA/cell After the mutant cell cultures have been grown at 37cC you again analyze these cells using FACS The plots below represent the different plot types from muta east strains: 2 3 3 2N 4N 2N 4N 2N 4N Amount of DNA/cell Amount of DNA/cell Anount _f DNA} ~ell For each of the following temperature sensitive mutations predict which FACS plot (A,B 0 C) you would expect, and explain your answer (1 point each) A mutation in M-cyclin that prevented it from binding to M-Cdk mutation that prevented initiation of replication mutation that prevented the dephosphorylation f S-Cdk An inactivating mutation in the anaphase promoting complex (APC)

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

g you have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove thei

g ou have a different mutant mouse who has low blood glucose in response to stress and you do not know where the mutation is. to help find out, you remove their

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

which of the following require physical contact between two bacterial cells for dna transfer?

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

kumargaurav1012000 kumargaurav1012000 · Answer 1 · 2022-12-07T23:53:30-05:00

25 min; 62 min; and M min; Assuming the cell cycle duration is constant between the two temperature ranges: Which graph represents the population of yeast cells bearing a temperature-sensitive mutation? 40 minutes after transferring the cells to the limiting temperature of 0 "2 0l#6, Cdc6, which often interacts with ORC, was studied.

A mutation in biology is an adjustment to the nucleic acid sequence of an organism's, virus's, or extrachromosomal DNA. DNA or RNA can be found in the viral genome. Errors in DNA replication, viral replication, mitosis, meiosis, or other types of DNA damage (such as pyrimidine dimers from exposure to ultraviolet radiation) can result in mutations, which can then result in error-prone repair (especially microhomology-mediated end joining), error-causing repair in other forms, or error-causing replication. Due to mobile genetic elements, mutations can also result from the insertion or deletion of DNA segment.

An organism's observable traits, or phenotype, may or may not change as a result of a mutation. The role of mutations in both normal and pathological biological processes

To learn more about mutation please click on the given

https://brainly.com/question/17031191

#SPJ4