jdiffenbaugh360 jdiffenbaugh360

23-12-2022
Biology

Answered

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both glucose and starch were added to the artificial cell, where would the starch be located after 20 minutes?answer choicesBoth inside and outside of the cellOutside of the cell onlyInside of the cell onlyIt would deteriorate and disappear

Answer :

Other Questions

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

Which of the following predicts what would happen if glucose moved by facilitated diffusion instead?

Can anyone do this for me like 10-20 minutes?

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

microtubules pull the lined-up chromosomes apart :prophase metaphase anaphase telophase cytokinesis the cytoplasm divides, forming 2 identical daughter cells th

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista