A(n) ______ is a stretch of DNA consisting of an operator, a promoter, and genes for a related set of proteins, usually making up an entire metabolic pathway.

Question

05-12-2022
Biology

Answered

A(n) ______ is a stretch of DNA consisting of an operator, a promoter, and genes for a related set of proteins, usually making up an entire metabolic pathway.

Answer :

Other Questions

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following require physical contact between two bacterial cells for dna transfer?

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

What is the functional significance of the fact that the da and ne transporter proteins are not selective for their respective neurotransmitters?

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

jaiswalsaurabh45609 jaiswalsaurabh45609 · Answer 1 · 2022-12-11T23:30:24-05:00

A(n) operon is a stretch of DNA consisting of an operator, a promoter, and genes for a related set of proteins, usually making up an entire metabolic pathway.

An operon is a functional piece of DNA in genetics that houses a collection of genes that are all regulated by the same promoter. The genes are combined during transcription to form an mRNA strand, which is then either translated in the cytoplasm as a single unit or split into monocistronic mRNAs, which are translated individually and consist of many strands of mRNA that each encode a single gene product. The operon's genes as a result either express themselves simultaneously or not at all. An operon is defined by the co-transcription of many genes.

To know more about operon, click here,

brainly.com/question/13576345

#SPJ4