which of the following act as a code book for synthesizing specific proteins required to perform specific body tasks?a. organsb. cellsc. RNAd. DNA

Question

05-12-2022
Biology

Answered

which of the following act as a code book for synthesizing specific proteins required to perform specific body tasks?a. organsb. cellsc. RNAd. DNA

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

which of the following require physical contact between two bacterial cells for dna transfer?

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

Compare skeletal, smooth, and cardiac muscles as to their microscopic anatomy, location and arrangement in body organs, and function in the body.

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

What is the functional significance of the fact that the da and ne transporter proteins are not selective for their respective neurotransmitters?

ATP is required for RNA-Pol to move down dsDNA, hydrolysis of ATP provides the energy to unwind the strands in front of RNAP while rewinding them behind. O True

akursharma9034 akursharma9034 · Answer 1 · 2022-12-08T02:13:24-05:00

Messenger RNA (mRNA) is the name given to the type of RNA that carries the information from the DNA out of the nucleus and into the cytoplasm to create a protein.

All seafood products, meat, poultry, and eggs, as well as beans, peas, and lentils, as well as nuts, seeds, and soy products, are considered protein foods. Lentils, beans, and peas are additional members of the vegetable group.

Learn more about the Messenger RNA (mRNA)

https://brainly.com/question/24567968

#SPJ4