Which of the following occurs during apoptosis?
(A) lysis of the cell
(B) direct contact between signaling cells
(C) fragmentation of the DNA
(D) release of proteases outside the cell

Question

05-12-2022
Biology

Answered

Which of the following occurs during apoptosis?
(A) lysis of the cell
(B) direct contact between signaling cells
(C) fragmentation of the DNA
(D) release of proteases outside the cell

Answer :

Other Questions

which of the following require physical contact between two bacterial cells for dna transfer?

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

contexto1212 contexto1212 · Answer 1 · 2022-12-07T11:37:38-05:00

The correct option is D : Fragmentation of the DNA ; The splitting or breaking of DNA strands into bits is known as DNA fragmentation. It can be done purposely by laboratory people or cells, or it might happen accidentally.

Spontaneous or inadvertent DNA fragmentation is the accumulation of fragments in a cell over time.

Blebbing, cell shrinkage, nuclear fragmentation, and DNA fragmentation are all signs of apoptosis.

Apoptotic cells, in contrast to necrosis, create apoptotic bodies that are phagocytized by surrounding cells without the loss of cellular contents.

Caspases, proteolytic enzymes that cause cell death by cleaving particular proteins in the cytoplasm and nucleus, induce apoptosis.

Caspases exist as inactive precursors, or procaspases, in all cells, and are normally triggered by cleavage by other caspases, resulting in a proteolytic caspase cascade.

Learn more about to DNA fragmentation visit here;

https://brainly.com/question/15093255

#SPJ4

Which of the following occurs during apoptosis? (A) lysis of the cell (B) direct contact between signaling cells (C) fragmentation of the DNA (D) release of proteases outside the cell

Answer :

Other Questions

Which of the following occurs during apoptosis?
(A) lysis of the cell
(B) direct contact between signaling cells
(C) fragmentation of the DNA
(D) release of proteases outside the cell