in the experiments this semester, you saw many different colors. please select the color that most closely matches what you observed in these experiments. the color of dna as isolated from strawberries: colorless the color of the bromocresol green solution you used before the addition of any albumin: the color of the complex of dna with propidium iodide:

Question

09-12-2022
Biology

Answered

in the experiments this semester, you saw many different colors. please select the color that most closely matches what you observed in these experiments. the color of dna as isolated from strawberries: colorless the color of the bromocresol green solution you used before the addition of any albumin: the color of the complex of dna with propidium iodide:

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

gray seed color in peas is dominant to white. assume that mendel conducted a series of experiments where plants with gray seeds were crossed among themselves, a

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

in fruit flies red eye color (R) is dominant to white eyes (r) in a cross between two flies, 50% of the male and 50% of the female offspring had red eyes. The o

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Which of the following is most closely associated with hairlike receptors in the semicircular canals?

Determine whether the following phrases describe type I topoisomerases, type II topoisomerases, or both type I and type II topoisomerases. Type I Topoisomerases

SrikanthPMR SrikanthPMR · Answer 1 · 2022-12-15T13:45:43-05:00

A fluorescent DNA dye that is not membrane permeable is propidium iodide. For use in flow cytometry, in situ hybridization, and immunohistochemistry, it is utilized to stain apoptotic cells Belloc et al (1994). Additionally, it can be utilized to distinguish between necrotic and apoptotic cell death.

Propidium iodide stains DNA in what ways?

A cell-impermeant DNA binding dye that can be used to stain cells and nucleic acids is called propidium iodide (PI). One dye binds to every 4-5 base pairs of DNA when PI intercalates between the bases to bind to DNA. Sequence preference is either negligible or absent.

How do cells get stained with propidium iodide?

A membrane-impermeant dye called propidium iodide (PI) is often rejected from live cells. It intercalates between bases in double-stranded DNA to attach to it. PI is stimulated at 488 nm and emits at a maximal wavelength of 617 nm after a somewhat high Stokes shift.

To know more about propidium iodide visit:-

https://brainly.com/question/6184701

#SPJ4