charleagrace4048 charleagrace4048

09-12-2022
Biology

Answered

Which of the following explains why the human population has so many phenotypic differences?
A) The majority of our genome consists of noncoding DNA.
B) The majority of our genome consists of DNA that codes for proteins.
C) Recombination allows for new genetic combinations.
D) The genes that code for what we look like are more susceptible to mutation than other genes.
E) None of the answer options are correct.

Answer :

KunalYadav273 KunalYadav273

15-12-2022

The right answer, based on the above statement, is that recombination results in novel genetic combinations.

What does a human genome look like?

The total revenue of DNA instructions existing in a cell makes up the genome. The genetic information is made up of 23 sets of chromosomes that are found in the dna and one tiny chromosome that is found in the mitochondria. All that a person needs to develop and operate is encoded in their DNA.

How many genomes are there in humans?

The genome is divided into 23 pairs of sex chromosomes (XX there in female and (XY) as in male), as well as 22 paired chromosomes, known as autosomes.

To know more about Genome visit:

https://brainly.com/question/29482089

#SPJ4

Answer Link

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

use the list of choices below for the following question: i. helicase ii. dna polymerase iii iii. ligase iv. dna polymerase i v. primase which of the enzymes co

which of the following is thought to have been the first step in the origin of life? group of answer choices replication of primitive genes formation of polypep

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

which of the following require physical contact between two bacterial cells for dna transfer?

old-growth forests can be described by which of the following group of answer choices a clear forest floor free of dead wood or debris are considered good choic

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that