which of these dna molecules is the shortest? a gel with the negative electrode at the top and the positive electrode at the bottom. the loading well is located at the top. dna fragments are labeled a, b, c, d, and e. fragment a is located at the top near the loading well. fragment b is located just below fragment a. fragment c is about halfway down the gel, and fragment d is just below it. fragment e is furthest down the gel, closest to the positive electrode. which of these dna molecules is the shortest? a gel with the negative electrode at the top and the positive electrode at the bottom. the loading well is located at the top. dna fragments are labeled a, b, c, d, and e. fragment a is located at the top near the loading well. fragment b is located just below fragment a. fragment c is about halfway down the gel, and fragment d is just below it. fragment e is furthest down the gel, closest to the positive electrode. a b c d e

Question

16-12-2022
Biology

Answered

which of these dna molecules is the shortest? a gel with the negative electrode at the top and the positive electrode at the bottom. the loading well is located at the top. dna fragments are labeled a, b, c, d, and e. fragment a is located at the top near the loading well. fragment b is located just below fragment a. fragment c is about halfway down the gel, and fragment d is just below it. fragment e is furthest down the gel, closest to the positive electrode. which of these dna molecules is the shortest? a gel with the negative electrode at the top and the positive electrode at the bottom. the loading well is located at the top. dna fragments are labeled a, b, c, d, and e. fragment a is located at the top near the loading well. fragment b is located just below fragment a. fragment c is about halfway down the gel, and fragment d is just below it. fragment e is furthest down the gel, closest to the positive electrode. a b c d e

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

I need 8-10 examples of positive and negative feedback mechanism.

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

. Look up current ocean pH values. How do the current values compare to those from previous years? ((my answer: 8.1 pH today and 8.2 pH previously (slightly bas

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

. using the pictures below, identify the phases of the cell cycle using the words: interphase, prophase, metaphase, anaphase, telophase and cytokinesis

after completing the animation, briefly report your findings. list each organelle, where you found it in the cell, and what its primary function is. write your

Alligators are predators that live in the Florida Everglades. A scientist is using a computer model to determine whether the alligator is a keystone species in

jaiswaljyoti jaiswaljyoti · Answer 1 · 2022-12-27T01:39:06-05:00

The shortest DNA molecule is Fragment A. that is due to the fact it's far positioned on the top close to the loading well.

Fragment B is simply below Fragment A, and Fragment C is about midway down the gel. Fragment D is just underneath Fragment C, and Fragment E is the furthest down the gel, closest to the positive electrode.

The manner gels paintings is that DNA molecules are loaded into the properly at the top of the gel and then an electrical cutting-edge is applied. The smaller molecules pass quicker and end up further down the gel. As Fragment A is the closest to the loading properly, it's miles the smallest molecule, and therefore the shortest. therefore, Fragment A is the shortest DNA molecule.

To know more about DNA click here

https://brainly.com/question/21992450

#SPJ4