bammbamm9983 bammbamm9983

23-12-2022
Biology

Answered

after completing the animation, briefly report your findings. list each organelle, where you found it in the cell, and what its primary function is. write your report in the essay box below.

Answer :

Other Questions

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

Sort the following list so that the stages of meiosis 1 appear in order. Remember You start with 1 cell and end with 2 cells

A human cheek cell's cycle is 24 hours. The stages within the cell cycle vary in length. G1 phase - 11 hours, G2 phase - 4 hours, S phase - 8 hours, M phase - 1

Can’t edit the box, could someone tell me the probability?

Calculate the SA:V ratio for a spherical cell with a radius of 5 and the SA:V ratio of a single cuboidal cell with a side *7. Then, state which cell would be mo

i. describe (list) the events from the time calcium ions enter the terminal axon at the neuromuscular junction through muscle cell contraction.

gray seed color in peas is dominant to white. assume that mendel conducted a series of experiments where plants with gray seeds were crossed among themselves, a

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

-------- alveolar cells provide the primary diffusional area for gas exchange with the blood in the lung

the enterotoxin of the bacterium clostridium perfringens upregulates the expression of human claudins, including cldn6. given the information in the passage, ho