The presence of a solute reduces the vapor pressure of the solvent above the solution, raising its boiling point. Since living cells are surrounded by biological solutions separated by a semipermeable membrane, the osmotic pressure must be higher in the cell than outside the cell membrane.

Question

16-12-2022
Biology

Answered

The presence of a solute reduces the vapor pressure of the solvent above the solution, raising its boiling point. Since living cells are surrounded by biological solutions separated by a semipermeable membrane, the osmotic pressure must be higher in the cell than outside the cell membrane.

Answer :

Other Questions

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

in biology, the relationship between form and function is critical. briefly explain how this is apparent at the level of the cell. your answer should include a

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

More than one of the following may be correct. Select all correct choices. A sharp increase in capillary hydrostatic pressure would directly cause

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

microtubules pull the lined-up chromosomes apart :prophase metaphase anaphase telophase cytokinesis the cytoplasm divides, forming 2 identical daughter cells th

after completing the animation, briefly report your findings. list each organelle, where you found it in the cell, and what its primary function is. write your

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

arenasaleem890 arenasaleem890 · Answer 1 · 2022-12-21T01:21:31-05:00

Osmotic pressure is the pressure caused by water at different concentrations due to the dilution of water by dissolved molecules (solute), notably salts and nutrients.

Higher temperatures are required to achieve the boiling point because solute particles reduce the liquid solvent's vapour pressure. Boiling point elevation is the name given to this phenomena. The boiling point of water rises by approximately 0.5°C for every mole of particles dissolved in a litre of water. The quantity of solvent molecules at the surface and the solvent's vapour pressure both drop when a solute is dissolved in a solvent.The mere existence of the solute reduces the flow of solvent molecules into and out of the system, which decreases the equilibrium vapour pressure since only solvent molecules near the surface may escape (evaporate).

To learn more about Osmotic pressure click the link below:

brainly.com/question/12497098

#SPJ4