which of the following events in transcription initiation likely occurs last? view available hint(s)for part e which of the following events in transcription initiation likely occurs last? tbp is recruited to the promoter. regulatory transcription factors bind to enhancers. basal transcription factors form a basal transcription complex. rna polymerase binds to the promoter of the gene.

Question

09-12-2022
Biology

Answered

which of the following events in transcription initiation likely occurs last? view available hint(s)for part e which of the following events in transcription initiation likely occurs last? tbp is recruited to the promoter. regulatory transcription factors bind to enhancers. basal transcription factors form a basal transcription complex. rna polymerase binds to the promoter of the gene.

Answer :

Other Questions

During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of a growing protein chain when a. the ribosomal RNA anticodo

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

which of the listed local anesthetics could produce an emergency situation characterized by the inability of the blood to bind to oxygen? group of answer choice

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Vygotsky theory emphasizes which of the following factors in a child's development? - social interactions in cultural contexts - individual differences in traje

which of the following represents inversion chromosomal mutation in this sequence of dna 5' c t a g t t g c a a t 3' 5' c t a t t g g c a a t 3' 5' c t a g g c

Paruljain Paruljain · Answer 1 · 2022-12-17T12:42:02-05:00

RNA polymerase binds to the promoter of the gene, events in transcription initiation likely occurs last.

A DNA fragment is copied into RNA during transcription. Messenger RNA is created when specific DNA sequences are translated into RNA molecules that can encode proteins (mRNA). Non-coding RNAs are RNA molecules that contain copies of other DNA sequences (ncRNAs). Only 1% to 3% of all RNA samples are mRNA. A minimum of 80% of mammalian genomic DNA can be actively transcribed (in one or more types of cells), with the bulk of this 80% being ncRNA. In contrast, less than 2% of the human genome can be transcribed into mRNA. The RNA is known as messenger RNA (mRNA) if the stretch of DNA is translated into an RNA molecule that encodes a protein. The mRNA then acts as a template for the translation of the protein. Other DNA stretches may be translated into larger non-coding RNAs like ribosomal RNA (rRNA) and long non-coding RNA as well as smaller non-coding RNAs like microRNA, transfer RNA (tRNA), small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), or enzymatic RNA molecules called ribozyme. Overall, RNA is essential for carrying out tasks within a cell since it aids in the synthesis, control, and processing of proteins.

To know more about transcription please refer: https://brainly.com/question/14136689

#SPJ4