The retinoblastoma (RB) protein serves as the guardian of the G1/S cell cycle checkpoint by inhibiting which molecule from activating transcription of genes necessary for DNA replication?
A. telomerase
B. E2F
C. reverse transcriptase
D. MAP kinase
B. E2F

Question

06-12-2022
Biology

Answered

The retinoblastoma (RB) protein serves as the guardian of the G1/S cell cycle checkpoint by inhibiting which molecule from activating transcription of genes necessary for DNA replication?
A. telomerase
B. E2F
C. reverse transcriptase
D. MAP kinase
B. E2F

Answer :

Other Questions

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

During translation, the amino acid detaches from the transfer RNA molecule and attaches to the end of a growing protein chain when a. the ribosomal RNA anticodo

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

which of the following foods are good sources of preformed or active vitamin a? (select all that apply.) a. carrots b. sweet potatoes c. leafy greens d. milk e.

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

Give the % yield if 1.78 g of O₂ is produced %Yield = Actual Yield/ Theoretical Yield x 100% %Yield = _________x 100%. = ____?______ %

abhinavjh321 abhinavjh321 · Answer 1 · 2022-12-08T11:15:05-05:00

The E2F molecule is prevented from triggering the transcription of the genes required for DNA replication by the retinoblastoma (RB) protein, which acts as the guardian of the G1/S cell cycle checkpoint.

A key player in the inhibition of the cell cycle and the development of tumors is the tumor suppressor protein Rb. It has been established that the Rb protein (pRb) is in charge of a crucial G1 checkpoint that prevents cell development and entry into the S phase. At the promoters of genes necessary for the advancement of the S phase and cell proliferation, RB binds to members of the E2F family. The G1/S cell cycle is halted by the binding of RB to E2F proteins, which either prevents the recruitment of transcriptional co-activators or attracts transcriptional co-repressors to these promoters.

To learn more about retinoblastoma click here https://brainly.com/question/20038394

#SPJ4

The retinoblastoma (RB) protein serves as the guardian of the G1/S cell cycle checkpoint by inhibiting which molecule from activating transcription of genes necessary for DNA replication? A. telomerase B. E2F C. reverse transcriptase D. MAP kinase B. E2F

Answer :

Other Questions

The retinoblastoma (RB) protein serves as the guardian of the G1/S cell cycle checkpoint by inhibiting which molecule from activating transcription of genes necessary for DNA replication?
A. telomerase
B. E2F
C. reverse transcriptase
D. MAP kinase
B. E2F