when you added primary antibody to the wells, what happened if your sample did not contain the antigen

Question

05-12-2022
Biology

Answered

when you added primary antibody to the wells, what happened if your sample did not contain the antigen

Answer :

Other Questions

after completing the animation, briefly report your findings. list each organelle, where you found it in the cell, and what its primary function is. write your

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

which of the following statements about the clonal selection theory of immune system function is false? -a. antigens are recognized by receptor proteins inside

-------- alveolar cells provide the primary diffusional area for gas exchange with the blood in the lung

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Imagine you are a grape farmer you grow black grapes one day you notice that one of the grape vines that is growing in your arbor which has always produced balc

You are going mountain climbing and get flown by helicopter from sea level to base camp which is a considerable elevation gain. How will your body respond to th

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

Paruljain Paruljain · Answer 1 · 2022-12-07T10:41:35-05:00

when you added primary antibody to the wells, If the antigen was not detected, the main antibody was washed off.

Antibodies and proteins shield you from harmful chemicals when they come into touch with your body. Antibodies are created by your immune system to bind to these foreign chemicals and remove them from your body. Immunoglobulin is another term for an antibody. A foreign substance that enters your body is referred to as an antigen. This includes venom, allergens, bacteria, viruses, fungus, and other poisons. Your immune system makes an antibody protein that it employs to find and eliminate particular antigen. Surface molecules on antigens are different from ones your body typically produces. Your immune system thus recognizes an antigen as soon as it enters your body. Your immune system requests antibody defense in order to fight against this antigen invasion. The B cell produces antibodies (specialized white blood cells). A B cell expands and clones when it comes into touch with an antigen. These plasma cells, also known as cloned B cells, continuously produce antibodies into your lymphatic and blood systems.

To know more about antigen please refer: https://brainly.com/question/15694610

#SPJ4