label the 5' and 3' ends of the template and primer strands in this image, from left to right in the image.

Question

05-12-2022
Biology

Answered

label the 5' and 3' ends of the template and primer strands in this image, from left to right in the image.

Answer :

Other Questions

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

In the image below, which objects would have a greater gravitational force between them, Objects A and B, or Objects B and C? Give one supporting detail for you

The recommendation were to "Consume less than 10% of calories from saturated fatty acids and less than 300 mg/d of cholesterol, and keep trans fatty acid consum

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

You have a friend that is a marathoner and an entrepreneur. He doesn't like lactic acid buildup in his muscles and is tired of them getting so hot when he exerc

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Based on this kind of biogeographical evidence, a scientist might propose the following hypothesis: The common ancestor of the cactus family evolved in the area

QWTiffany QWTiffany · Answer 1 · 2022-12-07T14:29:27-05:00

The correct option is template from 3' to 5' direction and primer from 5' to 3' direction.

The template strand is read from 3' to 5' direction. This is due to the reason that RNA primase that synthesized short strands of RNA from the template works only in one direction, which 5' to 3'. Owing to this, primer strand will be 5' to 3' and template will be from 3' to 5'.

DNA synthesis is bidirectional due to antiparallel nature of DNA. The opposite strands lead to synthesis in their respective 5' to 3' direction. DNA primase, helicase, topoisomerase, ligase and DNA polymerase are significant enzymes responsible for DNA replication.

Learn more about DNA replication -

https://brainly.com/question/21265857

#SPJ4

The complete question is attached in figure.