zainajaber0 zainajaber0

14-11-2022
Biology

Answered

Biology bar chart
Some student collected food packaging labels to find the nutrients present in bananas

Nutrients. Mass\g per 100g
Carbohydrate. 22.25
Fat. 0.25
Protein. 2.00
Fibre. 2.50

Please I need it fast

Biology bar chart Some student collected food packaging labels to find the nutrients present in bananas Nutrients Massg per 100g Carbohydrate 2225 Fat 025 Prote class=

Answer :

Other Questions

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Photosynthesis is a process of transformation of ENERGY. Which statement is FALSE : Sugars are the source of energy Light energy is tranformed Carbon Dioxyde (

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research

Help Please!! 50 Points Please have 3-4 Paragraphs What are 3 Different Endangered animal species in the Blue Ridge Mountains Describe the animals species rol

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

5. Draw a model that shows the organization of the human digestive system. Your model should include labels for and information about cells, tissues, organs, an

What are 3 example for: positive and beneficial mutation Negative and harmful mutation Neutral mutation

Which list includes only biotic parts of an ecosystem? A. Algae, grasses, animals OB. Mammals, birds, oxygen OC. Soil, water, air D. Decomposers, soil, nutrient