aidenlumpkins219 aidenlumpkins219

13-11-2022
Biology

Answered

Using the following genomic sequence:

1) Underline each intron

2) Circle each exon

UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG

AUAAUGUUUUUACCCACCAACGACGCCAUGUGACGUCGAAUGACUACCAAUGCU

GCUGGACUAACAUAAUCGUAUGGAAGGGUGUCAAUGUUCUCCUAUGUAAUGUAA

CAUAAU

Answer :

Other Questions

1. The following experiment was designed to test whether different concentration gradients affect the rate of diffusion. In this experiment, four solutions (0%

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

Which of the following actions would improve livestock waste treatment by limiting the amount of pollution initially produced? methane recapture regulating the

please.. EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at least two of these ar

Which of following does not describe a common reason people immigrate? (4 points) Drought in the area To avoid conflict or war New job opportunities More housin

How does mitosis help our sequoia tree become so big? Question 5 options: Mitosis makes gametes that are genetically different in order to produce seeds for th

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

HELP 40 POINTS!! Complete the 2 pages

EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at least two of these are relate