saralynahi20 saralynahi20

14-11-2022
Biology

Answered

Photosynthesis is a process of transformation of ENERGY. Which statement is FALSE :

Sugars are the source of energy

Light energy is tranformed

Carbon Dioxyde (CO2 ) is is used

Occurs only in cells with Chloroplasts

Answer :

Other Questions

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research

9.3 Process of Photosynthesis page 291-297 Question 1, 2, 3, 5

What are 3 example for: positive and beneficial mutation Negative and harmful mutation Neutral mutation

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i

Which criterion is a requirement for naturalization as a US citizen? A. The person must be a lawful, permanent resident for five years. B. The person must r

5. Draw a model that shows the organization of the human digestive system. Your model should include labels for and information about cells, tissues, organs, an