Meily1516 Meily1516

13-11-2022
Biology

Answered

Which list includes only biotic parts of an ecosystem?
A. Algae, grasses, animals
OB. Mammals, birds, oxygen
OC. Soil, water, air
D. Decomposers, soil, nutrients

Answer :

Other Questions

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

How can this graph be changed to show climate data instead of weather data? A. by showing monthly totals instead of daily and adding historical monthly averages

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i

Diverse plant communities have species representing a variety of plant types such as grasses, shrubs, succulents, hardwood trees, softwood trees, vines, ferns,

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

16. Write About It Suppose you are a doctor with patients who are mountain climbers. Write a letter to these patients that explains how gas exchange is affected

the diagram at the top of this article demonstrates that- A photosynthisis gives off water and carbon dioxide B photosynthesis uses energy to make oxygen and su

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept