lovemluna45 lovemluna45

13-11-2022
Biology

Answered

What are 3 example for:

positive and beneficial mutation

Negative and harmful mutation

Neutral mutation

Answer :

Other Questions

•Explain if the mutation is beneficial, harmful, or neutral for the individual who has the genetic disorder. Explain why.The genetic disorder that I got is Albi

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

How does mitosis help our sequoia tree become so big? Question 5 options: Mitosis makes gametes that are genetically different in order to produce seeds for th

please.. EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at least two of these ar

5. Draw a model that shows the organization of the human digestive system. Your model should include labels for and information about cells, tissues, organs, an