2brg5hv7md 2brg5hv7md

13-11-2022
Biology

Answered

5. Draw a model that shows the organization of
the human digestive system. Your model should
include labels for and information about cells,
tissues, organs, and the organ system. Explain
how these levels of organization in the digestive
system help a person to survive.

Answer :

Other Questions

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

1. The following experiment was designed to test whether different concentration gradients affect the rate of diffusion. In this experiment, four solutions (0%

Imagine that our solar system is a bathtub filled with water and bath toys. The Sun is an open drain, pulling the water and toys toward it. In what ways is thi

please.. EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at least two of these ar

Noah developed a model of how genes are acquired by offspring in sexual reproduction. He used two baskets-one to represent each parent. He placed two slips of p

Juliet has asthma and regularly uses inhalers and a nebulizer, a machine to help improve her breathing with inhaled medicine. Juliet knows how important the res

How does mitosis help our sequoia tree become so big? Question 5 options: Mitosis makes gametes that are genetically different in order to produce seeds for th

A cell is the smallest unit of biological organization that has all of the characteristics of life. Which of the following are considered characteristics of lif