davionagarrett13 davionagarrett13

14-11-2022
Biology

Answered

Which criterion is a requirement for naturalization as a US citizen?

A.
The person must be a lawful, permanent resident for five years.
B.
The person must read, write, and speak at least two languages.
C.
The person must be related to a natural or naturalized citizen.
D.
The person must be between the ages of 18 and 55 years old

Answer :

Other Questions

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Supplemental Activities (These are optional and not graded - please do not submit) 1. Research and write a paper about two famous earth scientists. 2. Research

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

5. Draw a model that shows the organization of the human digestive system. Your model should include labels for and information about cells, tissues, organs, an

its correct meaning. 1. criteria pollutants 2. electrostatic precipitator 3. national ambient air quality standards 4. primary standards 5. secondary standards

Bonus Question: What is the height of the plant that was kept in the sun for 3 hours on day 10? 4. This line graph compares the growth of plants that were kept

Violet flowers are the dominant trait and white flowers are they recessive trait .what would the phenotype be for a heterozygous flower? a. violet b. white If

Procedure Note: The procedures for this lab as shown in the video are very good if you need extra help. 1. Tape the black paper to the outside of the jar so tha

What are 3 example for: positive and beneficial mutation Negative and harmful mutation Neutral mutation

explain the importance of the following. a The trachea wall contains C-shaped rings of cartilage. b The distance between the air in an alveolus and the blood i