hessonhutson1978 hessonhutson1978

13-11-2022
Biology

Answered

Violet flowers are the dominant trait and white flowers are they recessive trait .what would the phenotype be for a heterozygous flower?
a. violet
b. white

If two heterozygous flowers were to be crossed, what would be the phenotypes of the offspring
a. all white
b. all violet
c some violet, some white

Answer :

Other Questions

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

31. Use the diagram to answer the question below. What would happen to the solar energy that reaches Earth's atmosphere if the ground was covered w (1 point) 30

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

1. The following experiment was designed to test whether different concentration gradients affect the rate of diffusion. In this experiment, four solutions (0%

WORTH 100 POINT Specialized cells are not genetically identical because they have different structures and functions. True False The center of this image show

please.. EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at least two of these ar

Which of the following actions would improve livestock waste treatment by limiting the amount of pollution initially produced? methane recapture regulating the

PLEASE, PLEASE, PLEASEE!!! EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at le

EXPLAIN IN DETAIL HOW THE TWO RELATES TO THE CELL THEORY The following lists components of the nature of science. Explain how at least two of these are relate

How does mitosis help our sequoia tree become so big? Question 5 options: Mitosis makes gametes that are genetically different in order to produce seeds for th