short segments of newly synthesized dna are joined into a continuous strand by . short segments of newly synthesized dna are joined into a continuous strand by . dna polymerase primase single-strand binding protein ligase helicase

Question

16-12-2022
Biology

Answered

short segments of newly synthesized dna are joined into a continuous strand by . short segments of newly synthesized dna are joined into a continuous strand by . dna polymerase primase single-strand binding protein ligase helicase

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

4 grams of reactant, how many grams of product are produced by the chemical reaction

3. A controlled experiment allows the scientist to isolate and test a. b. c. a mass of information. d. a single variable.

when black and white chickens are mated, 25% of the offspring are black, 50% are checkerboard (black and white), and 25% are white. this trait is an example of

Which of the following is NOT one of Mendel's hypotheses to explain the results of his P, F1 and F2 crosses? a. Adult plants carry a pair of genes that will det

Which of the following correctly compares the structures of plant and animal cells? Both plant and animal cells have endoplasmic reticulum, where cellular respi

The recommendation were to "Consume less than 10% of calories from saturated fatty acids and less than 300 mg/d of cholesterol, and keep trans fatty acid consum

Round peas are dominant to wrinkled peas. Smooth pea pods are dominant to constricted pea pods. Two pea plants that are heterozygous for both traits are crossed

arenasaleem890 arenasaleem890 · Answer 1 · 2022-12-19T14:24:00-05:00

DNA ligases play a key role in maintaining genomic integrity by mending breaks in the phosphodiester backbone of DNA that occur during replication and recombination as well as as a result of DNA damage and subsequent repair.

Consequently, the enzyme Primasa synthesizes a primer, a small RNA fragment, as the first step in the production of DNA. The RNA polymerase known as Primasa uses DNA as a template. Every work by Okazaki begins with a Primer. The DNA polymerase III holoenzyme then creates the correct DNA fragment up until it comes into contact with the following primer. Then, DNA polymerase Ia takes the place of DNA polymerase Holoenzyme III. The function of DNA polymerase I's 5'P-3'OH exonueotic activity.Of order to make a double helix, two polynucleotide chains in deoxyribonucleic acid (DNA) coil around one another. All known organisms and many viruses have genetic information in the polymer that is necessary for their development, operation, growth, and reproduction. Nucleic acids include DNA and ribonucleic acid (RNA). Nucleic acids are one of the four main categories of macromolecules that are necessary for all known forms of life, along with proteins, lipids, and complex carbohydrates (polysaccharides)

To know more about DNA please refer ;https://brainly.com/question/14315652

#SPJ4