If you were to use a mutated plasmid in the pGlo experiment, one that no longer had a functional beta-lactamase gene, which statement below is the most likely observable outcome? Bacteria will not be able to grow on ampicillin plates Bacteria will not be able to break down arabinose The bacteria will not be able to express GFP There will be a significant change in the bacterial colony appearance The plasmid will no longer be able to be transformed into the bacterial cells

Question

16-12-2022
Biology

Answered

If you were to use a mutated plasmid in the pGlo experiment, one that no longer had a functional beta-lactamase gene, which statement below is the most likely observable outcome? Bacteria will not be able to grow on ampicillin plates Bacteria will not be able to break down arabinose The bacteria will not be able to express GFP There will be a significant change in the bacterial colony appearance The plasmid will no longer be able to be transformed into the bacterial cells

Answer :

Other Questions

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

Concept Review: Calculating Doubling Time Part A Part complete Drag the values on the left to the appropriate blanks on the right to complete the sentences. Not

which of the following require physical contact between two bacterial cells for dna transfer?

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

blood cells could be modified to better carry oxygen, which would help the athlete's muscles to not get sore as fast. lactic acid wouldn't build up as fast eith

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

choose the term that describes a bacteriophage infection in which the host bacteria are lysed and killed by the infection

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

arenasaleem890 arenasaleem890 · Answer 1 · 2022-12-21T01:54:27-05:00

Bacteria are microbes with a cell structure simpler than that of many other organisms. Their control centre, containing the genetic information, is contained in a single loop of DNA. Some bacteria have an extra circle of genetic material called a plasmid rather than a nucleus.

A competent strain of bacteria is injected with the DNA (often in the form of a plasmid) during transformation so that the bacteria can reproduce the desired sequence in numbers adequate for additional research and/or modification. A recombinant plasmid that has been inserted into a bacterial cell causes the cell to start expressing the genes on it. By employing the bacterial cell's machinery, DNA polymerase finds the ori- the origin of replication- and begins to duplicate the plasmid. A fundamental molecular biology approach is the heat shock method of transforming plasmid DNA into E. coli. It involves putting an alien plasmid or ligation product inside of bacteria.

To learn more about microbes click the link below:

brainly.com/question/14571536

#SPJ4