gabriellaramir4519 gabriellaramir4519

12-12-2022
Biology

Answered

which of the following is true about rna? the bases are held together by hydrogen bonds. the bases are complementary to each other. the structure is a double helix. it contains deoxyribose sugar. it is composed of the nucleotides adenine, guanine, cytosine, and uracil.

Answer :

Other Questions

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

which of the following is not an advantage of active transport? it is faster than passive transport. it does not require added energy. it is specific for a part

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

what is the skeletopy, synotopy and holotopy of the lung?

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

protein folding none of the responses are correct is completed by the time the protein is released from the ribosome is govern solely by the chemistry of the pr

ATP is required for RNA-Pol to move down dsDNA, hydrolysis of ATP provides the energy to unwind the strands in front of RNAP while rewinding them behind. O True

Free-floating periodontal pathogens can cause periodontal disease. Biofilm development always begins supragingival. Select one: A. Both statements are true B. B