tshegosmall8417 tshegosmall8417

23-12-2022
Biology

Answered

protein folding none of the responses are correct is completed by the time the protein is released from the ribosome is govern solely by the chemistry of the protein is completed when the polypeptide chain folds around itself

Answer :

Other Questions

Which of the following describes a critical role of cAMP during the transduction stage of a G protein signal transduction pathway?

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA?

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

what is the skeletopy, synotopy and holotopy of the lung?

which of the following is thought to have been the first step in the origin of life? group of answer choices replication of primitive genes formation of polypep

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the