A researcher hypothesizes that plant Ieaf cells express fewer genes in the middle of the night compared to right before the sun rises She tests her hypothesis by introducing DNase into the cells at both timnes. She finds that DNA Is cut ruch more right before the sun rises and that more mRNA is present in the cells at that time. The best interpretation of these results Is that only post-translational modification contributes to gene regulation between the two night periods chromatin regulation is a crucial component f plant gene regulation overnight plants do not change gene expression between the two night periods

Question

09-12-2022
Biology

Answered

A researcher hypothesizes that plant Ieaf cells express fewer genes in the middle of the night compared to right before the sun rises She tests her hypothesis by introducing DNase into the cells at both timnes. She finds that DNA Is cut ruch more right before the sun rises and that more mRNA is present in the cells at that time. The best interpretation of these results Is that only post-translational modification contributes to gene regulation between the two night periods chromatin regulation is a crucial component f plant gene regulation overnight plants do not change gene expression between the two night periods

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

which of the following is the best example of gene flow? group of answer choices genes are shuffled by chromosomal crossing over during meiosis. wind blows poll

which of the following require physical contact between two bacterial cells for dna transfer?

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

amar is making a cladogram. out of all the species he is using, he knows that species x and y are the least primitive and are the most closely related.where wil

operon operator repressor regulatory gene corepressor trp operon tryptophan lac operon allolactose inducible operon vs. repressible operon activator inducer cyc

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

from the following choices, choose all of the answers that increase the genetic variation among individuals in a sexually reproducing population of a plant that

based on the antibiotic-resistant bacteria lab, which of the following mechanisms of change in gene frequencies is responsible for the antibiotic resistance of

abhinavjh321 abhinavjh321 · Answer 1 · 2022-12-17T09:17:45-05:00

The best interpretation of these results Is that, key element of plant gene regulation is through chromatin regulation. All eukaryotes include chromatin that is crammed into nucleosomes.

Members of the histone protein family make up the bulk of the chromatin regulation protein component. Histone proteins may come near to DNA because of their positive charge. H3 and H4 are core histones that bind to DNA before other gene regulation and are located in the interior of the nucleosome. When DNA gene regulation is significantly compressed, the chromatin regulation architecture prevents transcription factors, polymerases, and other nuclear proteins from reaching it. Fruit production involves a series of developmental gene regulation stages, and crop output is greatly influenced by the fruit set process.

learn more about chromatin here:

https://brainly.com/question/1362224

#SPJ4