kolbiking2878 kolbiking2878

09-12-2022
Biology

Answered

the sense of taste is also known as the sense of taste is also known as maculation. sublation. olfaction. gustation. proprioception.

Answer :

DarfishaShaikh DarfishaShaikh

16-12-2022

Gustation is another name for the taste sense.

What in biology is gustation?

Gustation is the term used to describe the recognition of taste with sensory neurons in the oral cavity, primarily on the tongue. The nose is covered with thousands of tiny bumps known as papillae, and each one of these contains millions of taste buds.

What is the gustation process?

Gustation is the gustatory system's perception of the flavor or flavors of food that has been consumed. When molecules in food or any other substances interact with taste receptor cells found in the taste buds, taste is produced. In the oral mucosa, particularly on the tongue, are the taste buds.

To know more about gustation visit:

https://brainly.com/question/29597433

#SPJ4

Answer Link

Other Questions

routine monitoring of water in a reservoir has found a high count of e. coli. of the following, you would be most concerned that the contaminated water might al

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

what is the skeletopy, synotopy and holotopy of the lung?

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

the arctic tundra has remained frozen for thousands of years but is slowing thawing as global temperatures increase. once thawed, the environment and ecosystems

in only one parent is required to produce offspring. 2. is a method of reproduction for some types of bacteria. 4. some simple organisms, such as hydras and spo

Which of the following should be labeled with the patient's name, the date and time of collection, and the initials of the person collecting the specimen?

recombinant dna contains a segment of foreign dna is defined as a mix of human and animal dna is created from embryonic stem cells is a technique for repairing