Within a cell, the amount of protein made using a given mRNA molecule depends partly on...
A. the presence of certain transcription factors.
B. the rate at which the mRNA is degraded.
C. the degree of DNA methylation.
D. the number of introns present in the mRNA.

Question

06-12-2022
Biology

Answered

Within a cell, the amount of protein made using a given mRNA molecule depends partly on...
A. the presence of certain transcription factors.
B. the rate at which the mRNA is degraded.
C. the degree of DNA methylation.
D. the number of introns present in the mRNA.

Answer :

Other Questions

Defective proteins are often degraded quickly, making their effects temporary. Single amino acid substitutions caused by errors in mRNA transcription would not

Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before translation: One of the processing steps is splicing, where portio

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

In a large, randomly mating, population, the frequency of the allele for sickle-cell hemoglobin (s) is 0.028. The results of studies have shown that people with

Which of the following additions have been made to principles of the central dogma of biology? a)DNA codes for proteins b)DNA information cannot be converted ..

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

Which of the following would be an example of a biological influence into the development of a pathological fear of the sight of blood? a. The immediate assista

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

gene encodes a protein with the following amino acid sequence: a nonsense mutation caused by a single-base-pair substitution occurs in this gene, resulting in a

contexto38 contexto38 · Answer 1 · 2022-12-09T01:43:55-05:00

The amount of protein produced in a cell utilizing a particular mRNA molecule is somewhat influenced by the rate of mRNA degradation. Here option B is the correct answer.

DNA is converted into mRNA, which joins cytoplasmic ribosomes to act as a template for protein production. There are many levels at which gene expression is regulated.

One such regulatory system is the longevity of mRNA and the pace of its degradation which in turn influences the availability of templates again for the process of protein synthesis and so keeps a check on the overall quantity of protein being generated in a cell.

For instance, bacterial mRNA has a relatively short life cycle, which enables them to swiftly adjust the pattern of protein production in response to environmental changes.

To learn more about mRNA molecule

https://brainly.com/question/9439028

#SPJ4

Within a cell, the amount of protein made using a given mRNA molecule depends partly on... A. the presence of certain transcription factors. B. the rate at which the mRNA is degraded. C. the degree of DNA methylation. D. the number of introns present in the mRNA.

Answer :

Other Questions

Within a cell, the amount of protein made using a given mRNA molecule depends partly on...
A. the presence of certain transcription factors.
B. the rate at which the mRNA is degraded.
C. the degree of DNA methylation.
D. the number of introns present in the mRNA.