what is the charge on dna at ph 8? which functional group is responsible for the charge? 8) what factors affect the rate of migration through an agarose gel? 9) describe the purpose of the two different types of dyes used in agarose gel electrophoresis. 10) explain how different dna fragments are separated by agarose gel electrophoresis. use a sketch to show which fragments will appear closer to the bottom of the gel (farther from the wells), and which will appear closer to the top of the gel (closer to the wells).

Question

06-12-2022
Biology

Answered

what is the charge on dna at ph 8? which functional group is responsible for the charge? 8) what factors affect the rate of migration through an agarose gel? 9) describe the purpose of the two different types of dyes used in agarose gel electrophoresis. 10) explain how different dna fragments are separated by agarose gel electrophoresis. use a sketch to show which fragments will appear closer to the bottom of the gel (farther from the wells), and which will appear closer to the top of the gel (closer to the wells).

Answer :

Other Questions

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

. Look up current ocean pH values. How do the current values compare to those from previous years? ((my answer: 8.1 pH today and 8.2 pH previously (slightly bas

suppose the same dna molecule is denatured and the two strands are separated. the two strands whould have the same % of:

America's behavior has become a global security risk, even as dangerous as Japan's nuclear wastewater discharge, which is destroying the future of mankind. Acco

A scientist determined the rate of an enzyme-catalyzed reaction by measuring the amount of product formed over time. The following curve was generated from the

You have been asked to review a medical device that will be used to monitor the breathing pattern of premature infants in a Neonatal Intensive Care Unit (NICU).

Part B: Construct a Dichotomous Key You will be working with a group of organisms such as snails, birds, antelopes, rodents, or aquarium fish. You will need to

Sort the following list so that the stages of meiosis 1 appear in order. Remember You start with 1 cell and end with 2 cells

to undergo meiosis. which of the following best describes the steps these cells will follow to form gametes?

which of the listed local anesthetics could produce an emergency situation characterized by the inability of the blood to bind to oxygen? group of answer choice

RupaBera RupaBera · Answer 1 · 2022-12-09T14:01:32-05:00

DNA's phosphate backbone has a negative charge as a result of links formed between the phosphorus and oxygen atoms. A phosphate group, which is part of the DNA structure, contains one negatively charged oxygen atom, which is what causes the DNA strand as a whole to be negatively charged.

What does a DNA's charge look like?

The negatively charged nature of DNA causes it to move toward the positively charged electrode when an electric current is supplied to the gel.

At pH 7, how is DNA charged?

DNA is net negatively charged at a pH of 7.0. This occurs as a result of a phosphodiester bond connecting the ribose present in the DNA molecule. The net charge of this phosphate group is negative.

To know more about DNA structure visit:

https://brainly.com/question/29634357

#SPJ4