arrange the steps in a growth factor signaling pathway that promotes cell division in the correct order. start with the first step at the top.

Question

05-12-2022
Biology

Answered

arrange the steps in a growth factor signaling pathway that promotes cell division in the correct order. start with the first step at the top.

Answer :

Other Questions

pick the correct match. no cell wall, only plasma membrane: no large vacuole, only small ones: no chlorophyll or chloroplasts: cell plate and no centrioles in c

what is a pluripotent stem cell? cells found in the inner cell mass that of the blastocyst that can differentiate into any of the cell types except placental ce

alex listed the typical steps of fossil formation.1) an organism dies.2) the remains fall to the bottom of the ocean.3) the soft portions decay, and the hard po

An artificial cell filled with a glucose solution was placed in a beaker of water, as represented below. The beaker was left undisturbed for 20 minutes.If both

which of the following is a possible consequence of disabling the g2 checkpoint in the cell cycle?

label the trna and mrna with the appropriate terms. also, determine the correct sequence of bases for trna and the correct amino acid for the trna (refer to the

a student studying bird development recorded the mass of eggs from the time they were laid until the time they hatched in order to relate the mass of the egg to

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

DRAW IT : The graph here shows the pH difference across the inner mitochondrial membrane over time in an active respiring cell. At the time indicated by the ver

adeneine occurs in about the same percentage as in a sample of dna cytosine occurs in about the same percantage as in a sample of dna so that a always pairs wit

jaiswaljyoti jaiswaljyoti · Answer 1 · 2022-12-08T02:10:59-05:00

The steps in a growth factor signaling pathway that promotes cell division is activation , transduction , transcription and cell division .

1. A growth factor binds to and activates a receptor.

2. The activation of an intracellular signal transduction system.

3. The nucleus activates transcription factors.

4. Cell division-promoting genes are translated.

Cell division is controlled not only by extracellular mitogens but also by intracellular mechanisms that can limit cell proliferation. Many animal precursor cells, for example, divide a limited number of times before they stop and terminally differentiate into permanently arrested, specialized cells. Although the stopping mechanisms are poorly understood, a progressive increase in CKI proteins probably contributes in some cases.

To know more about cell division :

https://brainly.com/question/13312481.

#SPJ4.